Basic information for AC093523.1-203-10aa
| Peptide Name | AC093523.1-203-10aa |
| Genome Position | chr5:68942928-68942931,68960601-68960626[-] |
| Species | Human |
| Peptide Sequence | MLAVKTVELA |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.34 |
| Relative Molecular Mass | 1236.51 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000249335;AC093523.1 |
| Transcript ID/Name | ENST00000654078;AC093523.1-203 |
| Transcript Length | 1646 |
| Coding Ability | 0.4654 |
| DNA Sequence Corresponding to Peptide | ATGCTTGCCGTTAAAACTGTGGAACTGGCC |
|
Conservation
|
|
|