Basic information for AC093772.2-201-10aa-1
| Peptide Name | AC093772.2-201-10aa-1 |
| Genome Position | chr4:127229387-127229416[-] |
| Species | Human |
| Peptide Sequence | MVRPFAWIDS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.39 |
| Relative Molecular Mass | 1383.55 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000287101;AC093772.2 |
| Transcript ID/Name | ENST00000669239;AC093772.2-201 |
| Transcript Length | 1994 |
| Coding Ability | 0.2874 |
| DNA Sequence Corresponding to Peptide | ATGGTGAGGCCTTTTGCTTGGATAGATTCT |
|
Conservation
|
|
|