Basic information for AC093840.2-201-10aa-2
| Peptide Name | AC093840.2-201-10aa-2 |
| Genome Position | chr4:181591713-181591742[+] |
| Species | Human |
| Peptide Sequence | MQGIQVAHSI |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.55 |
| Relative Molecular Mass | 1245.41 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000286860;AC093840.2 |
| Transcript ID/Name | ENST00000655295;AC093840.2-201 |
| Transcript Length | 1537 |
| Coding Ability | 0.3123 |
| DNA Sequence Corresponding to Peptide | ATGCAAGGGATCCAGGTTGCACACTCAATA |
|
Conservation
|
|
|