Basic information for AC096576.6-201-10aa
| Peptide Name | AC096576.6-201-10aa |
| Genome Position | chr4:21521081-21521110[-] |
| Species | Human |
| Peptide Sequence | MIIEGNLIKR |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.34 |
| Relative Molecular Mass | 1348.6 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000286318;AC096576.6 |
| Transcript ID/Name | ENST00000668733;AC096576.6-201 |
| Transcript Length | 1814 |
| Coding Ability | 0.3523 |
| DNA Sequence Corresponding to Peptide | ATGATAATAGAGGGCAATTTAATTAAAAGA |
|
Conservation
|
|
|