Basic information for AC098617.1-204-10aa
| Peptide Name | AC098617.1-204-10aa |
| Genome Position | chr2:192028805-192028834[+] |
| Species | Human |
| Peptide Sequence | MLLYLHLNLA |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.47 |
| Relative Molecular Mass | 1362.62 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000233766;AC098617.1 |
| Transcript ID/Name | ENST00000609952;AC098617.1-204 |
| Transcript Length | 876 |
| Coding Ability | 0.3356 |
| DNA Sequence Corresponding to Peptide | ATGCTCTTATATTTGCATCTAAACCTGGCA |
|
Conservation
|
|
|