Basic information for AC098617.1-208-10aa
| Peptide Name | AC098617.1-208-10aa |
| Genome Position | chr2:192035390-192035407,192036132-192036143[+] |
| Species | Human |
| Peptide Sequence | MSTVLELLKT |
| Peptide Length | 10 |
| Unique | No (AC098617.1-209-10aa,AC098617.1-216-10aa-1,AC098617.1-217-10aa-1) |
| Grand Average of Hydropathicity | 0.79 |
| Relative Molecular Mass | 1296.6 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000233766;AC098617.1 |
| Transcript ID/Name | ENST00000597204;AC098617.1-208 |
| Transcript Length | 689 |
| Coding Ability | 0.4615 |
| DNA Sequence Corresponding to Peptide | ATGTCCACTGTTTTGGAGTTACTCAAGACC |
|
Conservation
|
|
|