Basic information for AC098617.1-215-10aa
| Peptide Name | AC098617.1-215-10aa |
| Genome Position | chr2:192044153-192044182[+] |
| Species | Human |
| Peptide Sequence | MLILYHYVII |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 2.14 |
| Relative Molecular Mass | 1439.75 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000233766;AC098617.1 |
| Transcript ID/Name | ENST00000594798;AC098617.1-215 |
| Transcript Length | 1152 |
| Coding Ability | 0.3134 |
| DNA Sequence Corresponding to Peptide | ATGTTAATTCTCTACCACTATGTCATAATT |
|
Conservation
|
|
|