Basic information for AC098617.1-217-10aa-1
| Peptide Name | AC098617.1-217-10aa-1 |
| Genome Position | chr2:192035390-192035407,192036132-192036143[+] |
| Species | Human |
| Peptide Sequence | MSTVLELLKT |
| Peptide Length | 10 |
| Unique | No (AC098617.1-208-10aa,AC098617.1-209-10aa,AC098617.1-216-10aa-1) |
| Grand Average of Hydropathicity | 0.79 |
| Relative Molecular Mass | 1296.6 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000233766;AC098617.1 |
| Transcript ID/Name | ENST00000625221;AC098617.1-217 |
| Transcript Length | 805 |
| Coding Ability | 0.0745 |
| DNA Sequence Corresponding to Peptide | ATGTCCACTGTTTTGGAGTTACTCAAGACC |
|
Conservation
|
|
|