Basic information for AC105180.2-201-10aa
| Peptide Name | AC105180.2-201-10aa |
| Genome Position | chr8:134191712-134191741[-] |
| Species | Human |
| Peptide Sequence | MGENFRNLLI |
| Peptide Length | 10 |
| Unique | No (AC010733.2-201-10aa-4,AC007743.1-201-10aa,EIF1B-AS1-206-10aa-2,AP001977.1-202-10aa-2,PRKG1-AS1-206-10aa-2,AC007743.1-204-10aa-2) |
| Grand Average of Hydropathicity | 0.14 |
| Relative Molecular Mass | 1368.55 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000288067;AC105180.2 |
| Transcript ID/Name | ENST00000661266;AC105180.2-201 |
| Transcript Length | 2785 |
| Coding Ability | 0.4118 |
| DNA Sequence Corresponding to Peptide | ATGGGAGAAAATTTTCGCAACCTACTCATC |
|
Conservation
|
|
|