Basic information for AC105916.1-201-10aa-2
| Peptide Name | AC105916.1-201-10aa-2 |
| Genome Position | chr4:9645622-9645651[-] |
| Species | Human |
| Peptide Sequence | MRLLPRTSIP |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.03 |
| Relative Molecular Mass | 1345.63 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000287117;AC105916.1 |
| Transcript ID/Name | ENST00000653847;AC105916.1-201 |
| Transcript Length | 1495 |
| Coding Ability | 0.487 |
| DNA Sequence Corresponding to Peptide | ATGAGGCTTCTCCCCAGGACCAGCATTCCA |
|
Conservation
|
|
|