Basic information for AC106872.12-201-10aa
| Peptide Name | AC106872.12-201-10aa |
| Genome Position | chr4:164921993-164922022[+] |
| Species | Human |
| Peptide Sequence | MDKFKLQVLL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.55 |
| Relative Molecular Mass | 1396.69 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000285563;AC106872.12 |
| Transcript ID/Name | ENST00000649025;AC106872.12-201 |
| Transcript Length | 3700 |
| Coding Ability | 0.3397 |
| DNA Sequence Corresponding to Peptide | ATGGATAAATTTAAGCTCCAAGTACTATTG |
|
Conservation
|
|
|