Basic information for AC110102.1-201-10aa-1
| Peptide Name | AC110102.1-201-10aa-1 |
| Genome Position | chr4:44647112-44647141[-] |
| Species | Rat |
| Peptide Sequence | MCFLPTPPAV |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.15 |
| Relative Molecular Mass | 1237.52 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSRNOG00000056346;AC110102.1 |
| Transcript ID/Name | ENSRNOT00000080355;AC110102.1-201 |
| Transcript Length | 1358 |
| Coding Ability | 0.4779 |
| DNA Sequence Corresponding to Peptide | ATGTGCTTCCTACCAACTCCTCCAGCAGTG |
|
Conservation
|
|
|