Basic information for AC124290.1-204-10aa-1
| Peptide Name | AC124290.1-204-10aa-1 |
| Genome Position | chr8:35996288-35996317[+] |
| Species | Human |
| Peptide Sequence | MFFNVWTLKS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.57 |
| Relative Molecular Mass | 1434.69 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000253452;AC124290.1 |
| Transcript ID/Name | ENST00000654426;AC124290.1-204 |
| Transcript Length | 4914 |
| Coding Ability | 0.4017 |
| DNA Sequence Corresponding to Peptide | ATGTTCTTTAATGTCTGGACATTGAAGAGC |
|
Conservation
|
|
|