Basic information for AC124290.1-205-10aa-1
| Peptide Name | AC124290.1-205-10aa-1 |
| Genome Position | chr8:36189341-36189370[+] |
| Species | Human |
| Peptide Sequence | MSLLEQPWLV |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.72 |
| Relative Molecular Mass | 1377.59 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000253452;AC124290.1 |
| Transcript ID/Name | ENST00000662333;AC124290.1-205 |
| Transcript Length | 3240 |
| Coding Ability | 0.4657 |
| DNA Sequence Corresponding to Peptide | ATGTCCTTATTGGAACAACCATGGCTTGTT |
|
Conservation
|
|
|