Basic information for AC124290.1-206-10aa-1
| Peptide Name | AC124290.1-206-10aa-1 |
| Genome Position | chr8:36190790-36190819[+] |
| Species | Human |
| Peptide Sequence | MIFLCVDVIL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 2.87 |
| Relative Molecular Mass | 1327.64 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000253452;AC124290.1 |
| Transcript ID/Name | ENST00000659919;AC124290.1-206 |
| Transcript Length | 1940 |
| Coding Ability | 0.5428 |
| DNA Sequence Corresponding to Peptide | ATGATTTTCCTATGTGTAGATGTGATATTG |
|
Conservation
|
|
|