Basic information for AC125248.1-201-10aa
| Peptide Name | AC125248.1-201-10aa |
| Genome Position | chr18:29540612-29540641[+] |
| Species | Rat |
| Peptide Sequence | MTALSLKIVE |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.11 |
| Relative Molecular Mass | 1266.53 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSRNOG00000060829;AC125248.1 |
| Transcript ID/Name | ENSRNOT00000080979;AC125248.1-201 |
| Transcript Length | 4441 |
| Coding Ability | 0.3781 |
| DNA Sequence Corresponding to Peptide | ATGACTGCCTTAAGTCTTAAGATTGTTGAA |
|
Conservation
|
|
|