Basic information for AC131571.1-201-10aa-1
| Peptide Name | AC131571.1-201-10aa-1 |
| Genome Position | chr11:31618984-31619013[-] |
| Species | Human |
| Peptide Sequence | MSYFLFFFFC |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 2.01 |
| Relative Molecular Mass | 1513.77 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000228061;AC131571.1 |
| Transcript ID/Name | ENST00000648611;AC131571.1-201 |
| Transcript Length | 3945 |
| Coding Ability | 0.3706 |
| DNA Sequence Corresponding to Peptide | ATGTCATACTTTCTCTTTTTCTTTTTTTGT |
|
Conservation
|
|
|