Basic information for AC134224.1-201-10aa
| Peptide Name | AC134224.1-201-10aa |
| Genome Position | chr1:221156449-221156478[-] |
| Species | Rat |
| Peptide Sequence | MVGINIAVLS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 2.02 |
| Relative Molecular Mass | 1178.39 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSRNOG00000062127;AC134224.1 |
| Transcript ID/Name | ENSRNOT00000093096;AC134224.1-201 |
| Transcript Length | 2350 |
| Coding Ability | 0.4472 |
| DNA Sequence Corresponding to Peptide | ATGGTAGGGATAAATATAGCTGTCTTAAGT |
|
Conservation
|
|
|