Basic information for AC134224.2-201-10aa
| Peptide Name | AC134224.2-201-10aa |
| Genome Position | chr1:221153228-221153257[-] |
| Species | Rat |
| Peptide Sequence | MQPVAGSLRS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.01 |
| Relative Molecular Mass | 1207.35 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSRNOG00000062155;AC134224.2 |
| Transcript ID/Name | ENSRNOT00000092869;AC134224.2-201 |
| Transcript Length | 709 |
| Coding Ability | 0.2595 |
| DNA Sequence Corresponding to Peptide | ATGCAGCCAGTAGCTGGATCCTTGAGGTCA |
|
Conservation
|
|
|