Basic information for AC137932.1-201-10aa-1
| Peptide Name | AC137932.1-201-10aa-1 |
| Genome Position | chr16:89296206-89296235[+] |
| Species | Human |
| Peptide Sequence | MCNYCSFSCL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.96 |
| Relative Molecular Mass | 1332.54 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000260279;AC137932.1 |
| Transcript ID/Name | ENST00000564394;AC137932.1-201 |
| Transcript Length | 1575 |
| Coding Ability | 0.5549 |
| DNA Sequence Corresponding to Peptide | ATGTGTAATTACTGCTCTTTCTCCTGCTTA |
m6A
|
Conservation
|
|
|