Basic information for AC138649.1-203-10aa
| Peptide Name | AC138649.1-203-10aa |
| Genome Position | chr15:22764423-22764452[+] |
| Species | Human |
| Peptide Sequence | MDYSYFLVTI |
| Peptide Length | 10 |
| Unique | No (AC138649.1-202-10aa-1) |
| Grand Average of Hydropathicity | 0.96 |
| Relative Molecular Mass | 1413.62 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000274253;AC138649.1 |
| Transcript ID/Name | ENST00000618814;AC138649.1-203 |
| Transcript Length | 429 |
| Coding Ability | 0.5315 |
| DNA Sequence Corresponding to Peptide | ATGGATTATTCGTATTTTTTGGTAACAATT |
|
Conservation
|
|
|