Basic information for AC139769.2-201-10aa
| Peptide Name | AC139769.2-201-10aa |
| Genome Position | chr19:23818099-23818128[-] |
| Species | Human |
| Peptide Sequence | MTRTLFYHLL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.57 |
| Relative Molecular Mass | 1456.78 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000267924;AC139769.2 |
| Transcript ID/Name | ENST00000599944;AC139769.2-201 |
| Transcript Length | 2291 |
| Coding Ability | 0.3994 |
| DNA Sequence Corresponding to Peptide | ATGACTAGAACCCTGTTCTACCACTTATTA |
m6A
|
Conservation
|
|
|