Basic information for AC160336.1-201-10aa-45
| Peptide Name | AC160336.1-201-10aa-45 |
| Genome Position | chr14:44631393-44631422[-] |
| Species | Mouse |
| Peptide Sequence | MTVFELCPLE |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.97 |
| Relative Molecular Mass | 1343.6 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000115801;AC160336.1 |
| Transcript ID/Name | ENSMUST00000226445;AC160336.1-201 |
| Transcript Length | 93147 |
| Coding Ability | 0.4015 |
| DNA Sequence Corresponding to Peptide | ATGACTGTTTTTGAGTTATGCCCTCTGGAA |
|
Conservation
|
|
|