Basic information for AC242426.2-203-10aa-2
| Peptide Name | AC242426.2-203-10aa-2 |
| Genome Position | chr1:147295654-147295683[+] |
| Species | Human |
| Peptide Sequence | MFCSVLVPVI |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 2.57 |
| Relative Molecular Mass | 1269.57 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000237188;AC242426.2 |
| Transcript ID/Name | ENST00000650785;AC242426.2-203 |
| Transcript Length | 2981 |
| Coding Ability | 0.2898 |
| DNA Sequence Corresponding to Peptide | ATGTTTTGCTCTGTTTTGGTACCTGTAATA |
m6A
|
Conservation
|
|
|