Basic information for AC244502.1-204-10aa-1
| Peptide Name | AC244502.1-204-10aa-1 |
| Genome Position | chr14:22382110-22382139[-] |
| Species | Human |
| Peptide Sequence | MKNLRLTLLK |
| Peptide Length | 10 |
| Unique | No (AC244502.1-201-10aa-1,AC244502.1-205-10aa,AC244502.1-203-10aa-1,AC244502.1-202-10aa,AC244502.1-210-10aa-2,AC244502.1-211-10aa-2) |
| Grand Average of Hydropathicity | 0.06 |
| Relative Molecular Mass | 1391.75 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000251002;AC244502.1 |
| Transcript ID/Name | ENST00000545670;AC244502.1-204 |
| Transcript Length | 571 |
| Coding Ability | 0.3135 |
| DNA Sequence Corresponding to Peptide | ATGAAGAACCTGAGGCTCACCTTGCTTAAG |
|
Conservation
|
|
|