Basic information for AF117829.1-206-10aa-3
| Peptide Name | AF117829.1-206-10aa-3 |
| Genome Position | chr8:89719680-89719709[-] |
| Species | Human |
| Peptide Sequence | MVVNSRTYLL |
| Peptide Length | 10 |
| Unique | No (AF117829.1-208-10aa-5) |
| Grand Average of Hydropathicity | 0.71 |
| Relative Molecular Mass | 1357.61 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000251136;AF117829.1 |
| Transcript ID/Name | ENST00000621883;AF117829.1-206 |
| Transcript Length | 3802 |
| Coding Ability | 0.3864 |
| DNA Sequence Corresponding to Peptide | ATGGTCGTGAACTCAAGGACTTACCTGTTA |
|
Conservation
|
|
|