Basic information for AF117829.1-212-10aa
| Peptide Name | AF117829.1-212-10aa |
| Genome Position | chr8:89587116-89587145[-] |
| Species | Human |
| Peptide Sequence | MGESIRKLCI |
| Peptide Length | 10 |
| Unique | No (AF117829.1-213-10aa-2) |
| Grand Average of Hydropathicity | 0.41 |
| Relative Molecular Mass | 1311.56 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000251136;AF117829.1 |
| Transcript ID/Name | ENST00000661105;AF117829.1-212 |
| Transcript Length | 2880 |
| Coding Ability | 0.3236 |
| DNA Sequence Corresponding to Peptide | ATGGGAGAAAGTATTCGCAAACTATGCATC |
m6A
|
Conservation
|
|
|