Basic information for AF117829.1-213-10aa-1
| Peptide Name | AF117829.1-213-10aa-1 |
| Genome Position | chr8:89598157-89598186[-] |
| Species | Human |
| Peptide Sequence | MKKCPPSLAI |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.27 |
| Relative Molecular Mass | 1249.53 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000251136;AF117829.1 |
| Transcript ID/Name | ENST00000658265;AF117829.1-213 |
| Transcript Length | 4686 |
| Coding Ability | 0.4093 |
| DNA Sequence Corresponding to Peptide | ATGAAAAAATGCCCACCATCATTGGCCATC |
|
Conservation
|
|
|