Basic information for AF117829.1-215-10aa-1
| Peptide Name | AF117829.1-215-10aa-1 |
| Genome Position | chr8:89722693-89722722[-] |
| Species | Human |
| Peptide Sequence | MWKVLSAFDI |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.99 |
| Relative Molecular Mass | 1371.58 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000251136;AF117829.1 |
| Transcript ID/Name | ENST00000658477;AF117829.1-215 |
| Transcript Length | 1934 |
| Coding Ability | 0.3511 |
| DNA Sequence Corresponding to Peptide | ATGTGGAAGGTACTGAGTGCTTTTGACATA |
|
Conservation
|
|
|