Basic information for AF117829.1-216-10aa-2
| Peptide Name | AF117829.1-216-10aa-2 |
| Genome Position | chr8:89722123-89722152[-] |
| Species | Human |
| Peptide Sequence | MHLSQVLNNV |
| Peptide Length | 10 |
| Unique | No (AF117829.1-207-10aa,AF117829.1-209-10aa-2,AF117829.1-208-10aa-1,AF117829.1-215-10aa-2,AF117829.1-217-10aa-1) |
| Grand Average of Hydropathicity | 0.34 |
| Relative Molecular Mass | 1316.49 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000251136;AF117829.1 |
| Transcript ID/Name | ENST00000521996;AF117829.1-216 |
| Transcript Length | 1442 |
| Coding Ability | 0.3447 |
| DNA Sequence Corresponding to Peptide | ATGCACCTCTCTCAAGTCTTGAACAATGTT |
|
Conservation
|
|
|