Basic information for AF127577.6-201-10aa-2
| Peptide Name | AF127577.6-201-10aa-2 |
| Genome Position | chr21:15050472-15050501[+] |
| Species | Human |
| Peptide Sequence | MLEPISITKT |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.35 |
| Relative Molecular Mass | 1294.58 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSG00000279390;AF127577.6 |
| Transcript ID/Name | ENST00000623352;AF127577.6-201 |
| Transcript Length | 2191 |
| Coding Ability | 0.4067 |
| DNA Sequence Corresponding to Peptide | ATGTTGGAGCCAATTTCTATAACCAAAACG |
m6A
|
Conservation
|
|
|