Basic information for AL022068.1-219-10aa
| Peptide Name | AL022068.1-219-10aa |
| Genome Position | chr6:19729670-19729699[-] |
| Species | Human |
| Peptide Sequence | MSVSRIEFCK |
| Peptide Length | 10 |
| Unique | No (AL022068.1-205-10aa,AL022068.1-223-10aa) |
| Grand Average of Hydropathicity | 0.24 |
| Relative Molecular Mass | 1361.58 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000228412;AL022068.1 |
| Transcript ID/Name | ENST00000670218;AL022068.1-219 |
| Transcript Length | 1579 |
| Coding Ability | 0.5852 |
| DNA Sequence Corresponding to Peptide | ATGTCTGTTTCACGAATAGAGTTCTGTAAA |
|
Conservation
|
|
|