Basic information for AL078590.2-202-10aa-2
| Peptide Name | AL078590.2-202-10aa-2 |
| Genome Position | chr6:134534442-134534471[-] |
| Species | Human |
| Peptide Sequence | MVVLTGNLEL |
| Peptide Length | 10 |
| Unique | No (AL078590.2-209-10aa-1,AL078590.2-213-10aa-1,AL078590.2-207-10aa-1) |
| Grand Average of Hydropathicity | 1.36 |
| Relative Molecular Mass | 1250.5 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000232310;AL078590.2 |
| Transcript ID/Name | ENST00000668477;AL078590.2-202 |
| Transcript Length | 1287 |
| Coding Ability | 0.1865 |
| DNA Sequence Corresponding to Peptide | ATGGTAGTACTAACAGGAAACCTAGAACTT |
|
Conservation
|
|
|