Basic information for AL080250.1-205-10aa
| Peptide Name | AL080250.1-205-10aa |
| Genome Position | chr6:75315649-75315678[+] |
| Species | Human |
| Peptide Sequence | MRYVLLLSSP |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.85 |
| Relative Molecular Mass | 1340.57 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000225793;AL080250.1 |
| Transcript ID/Name | ENST00000661161;AL080250.1-205 |
| Transcript Length | 5454 |
| Coding Ability | 0.2884 |
| DNA Sequence Corresponding to Peptide | ATGAGATATGTATTGCTACTATCATCACCA |
m6A
|
Conservation
|
|
|