Basic information for AL109615.2-201-10aa-5
| Peptide Name | AL109615.2-201-10aa-5 |
| Genome Position | chr6:44088022-44088051[+] |
| Species | Human |
| Peptide Sequence | MAWLFLSQRF |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.72 |
| Relative Molecular Mass | 1460.68 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000231881;AL109615.2 |
| Transcript ID/Name | ENST00000665400;AL109615.2-201 |
| Transcript Length | 25672 |
| Coding Ability | 0.472 |
| DNA Sequence Corresponding to Peptide | ATGGCCTGGCTTTTCCTGAGCCAGCGCTTC |
|
Conservation
|
|
|