Basic information for AL117372.1-204-10aa
| Peptide Name | AL117372.1-204-10aa |
| Genome Position | chr20:60760618-60760647[+] |
| Species | Human |
| Peptide Sequence | MLLPQRPFCP |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.2 |
| Relative Molecular Mass | 1363.64 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000276627;AL117372.1 |
| Transcript ID/Name | ENST00000653900;AL117372.1-204 |
| Transcript Length | 2016 |
| Coding Ability | 0.2703 |
| DNA Sequence Corresponding to Peptide | ATGCTCCTTCCTCAGAGACCTTTCTGTCCC |
|
Conservation
|
|
|