Basic information for AL121821.2-201-10aa
| Peptide Name | AL121821.2-201-10aa |
| Genome Position | chr14:41588204-41588233[-] |
| Species | Human |
| Peptide Sequence | MEENIHQLCI |
| Peptide Length | 10 |
| Unique | No (AL121821.2-202-10aa-1) |
| Grand Average of Hydropathicity | 0 |
| Relative Molecular Mass | 1391.57 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000258636;AL121821.2 |
| Transcript ID/Name | ENST00000557067;AL121821.2-201 |
| Transcript Length | 530 |
| Coding Ability | 0.4887 |
| DNA Sequence Corresponding to Peptide | ATGGAAGAAAATATTCACCAACTATGCATC |
m6A
|
Conservation
|
|
|