Basic information for AL121821.2-202-10aa-1
| Peptide Name | AL121821.2-202-10aa-1 |
| Genome Position | chr14:41584000-41584029[-] |
| Species | Human |
| Peptide Sequence | MEENIHQLCI |
| Peptide Length | 10 |
| Unique | No (AL121821.2-201-10aa) |
| Grand Average of Hydropathicity | 0 |
| Relative Molecular Mass | 1391.57 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000258636;AL121821.2 |
| Transcript ID/Name | ENST00000661475;AL121821.2-202 |
| Transcript Length | 4933 |
| Coding Ability | 0.4577 |
| DNA Sequence Corresponding to Peptide | ATGGAAGAAAATATTCACCAACTATGCATC |
|
Conservation
|
|
|