Basic information for AL121821.2-202-10aa-3
| Peptide Name | AL121821.2-202-10aa-3 |
| Genome Position | chr14:41597200-41597212,41604972-41604988[-] |
| Species | Human |
| Peptide Sequence | MVSRLSFLSH |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.64 |
| Relative Molecular Mass | 1338.52 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000258636;AL121821.2 |
| Transcript ID/Name | ENST00000661475;AL121821.2-202 |
| Transcript Length | 4933 |
| Coding Ability | 0.4577 |
| DNA Sequence Corresponding to Peptide | ATGGTGTCCAGACTGAGTTTTCTTTCACAT |
m6A
|
Conservation
|
|
|