Basic information for AL121936.1-201-10aa-1
| Peptide Name | AL121936.1-201-10aa-1 |
| Genome Position | chr6:26573906-26573935[+] |
| Species | Human |
| Peptide Sequence | MTLLGAQVWK |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.61 |
| Relative Molecular Mass | 1308.58 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000284607;AL121936.1 |
| Transcript ID/Name | ENST00000641660;AL121936.1-201 |
| Transcript Length | 2884 |
| Coding Ability | 0.2999 |
| DNA Sequence Corresponding to Peptide | ATGACTCTATTAGGCGCGCAGGTGTGGAAA |
|
Conservation
|
|
|