Basic information for AL133371.3-203-10aa
| Peptide Name | AL133371.3-203-10aa |
| Genome Position | chr14:20873573-20873602[-] |
| Species | Human |
| Peptide Sequence | MESITSPIPF |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.47 |
| Relative Molecular Mass | 1283.47 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000259130;AL133371.3 |
| Transcript ID/Name | ENST00000658315;AL133371.3-203 |
| Transcript Length | 660 |
| Coding Ability | 0.0455 |
| DNA Sequence Corresponding to Peptide | ATGGAATCCATTACATCACCGATCCCCTTC |
|
Conservation
|
|
|