Basic information for AL133482.1-201-10aa-2
| Peptide Name | AL133482.1-201-10aa-2 |
| Genome Position | chr10:113484798-113484827[-] |
| Species | Human |
| Peptide Sequence | MKFSSSNSLL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.17 |
| Relative Molecular Mass | 1275.41 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000286289;AL133482.1 |
| Transcript ID/Name | ENST00000658845;AL133482.1-201 |
| Transcript Length | 3611 |
| Coding Ability | 0.4093 |
| DNA Sequence Corresponding to Peptide | ATGAAGTTCTCATCATCAAATTCCTTGCTG |
|
Conservation
|
|
|