Basic information for AL136441.1-202-10aa-1
| Peptide Name | AL136441.1-202-10aa-1 |
| Genome Position | chr13:76598256-76598285[-] |
| Species | Human |
| Peptide Sequence | MFVSHINFFF |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.43 |
| Relative Molecular Mass | 1450.66 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000285572;AL136441.1 |
| Transcript ID/Name | ENST00000653636;AL136441.1-202 |
| Transcript Length | 5273 |
| Coding Ability | 0.4286 |
| DNA Sequence Corresponding to Peptide | ATGTTTGTCAGCCACATAAATTTCTTCTTT |
|
Conservation
|
|
|