Basic information for AL138828.1-202-10aa
| Peptide Name | AL138828.1-202-10aa |
| Genome Position | chr6:136034102-136034131[-] |
| Species | Human |
| Peptide Sequence | MVSAARSLDH |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.07 |
| Relative Molecular Mass | 1248.35 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000237596;AL138828.1 |
| Transcript ID/Name | ENST00000576956;AL138828.1-202 |
| Transcript Length | 1881 |
| Coding Ability | 0.4056 |
| DNA Sequence Corresponding to Peptide | ATGGTATCTGCAGCCAGAAGTTTGGATCAC |
|
Conservation
|
|
|