Basic information for AL138828.1-203-10aa-2
| Peptide Name | AL138828.1-203-10aa-2 |
| Genome Position | chr6:136044374-136044403[-] |
| Species | Human |
| Peptide Sequence | MAICKLFYSF |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.41 |
| Relative Molecular Mass | 1384.65 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000237596;AL138828.1 |
| Transcript ID/Name | ENST00000419926;AL138828.1-203 |
| Transcript Length | 1570 |
| Coding Ability | 0.2911 |
| DNA Sequence Corresponding to Peptide | ATGGCAATTTGTAAGCTATTTTATTCCTTC |
|
Conservation
|
|
|