Basic information for AL138828.1-216-10aa-1
| Peptide Name | AL138828.1-216-10aa-1 |
| Genome Position | chr6:136225557-136225586[-] |
| Species | Human |
| Peptide Sequence | MPLLLLWLPP |
| Peptide Length | 10 |
| Unique | No (AL138828.1-213-10aa) |
| Grand Average of Hydropathicity | 1.52 |
| Relative Molecular Mass | 1354.67 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSG00000237596;AL138828.1 |
| Transcript ID/Name | ENST00000655618;AL138828.1-216 |
| Transcript Length | 2600 |
| Coding Ability | 0.4788 |
| DNA Sequence Corresponding to Peptide | ATGCCTTTGCTCCTCCTTTGGCTTCCACCA |
m6A
|
Conservation
|
|
|