Basic information for AL138930.1-201-10aa
| Peptide Name | AL138930.1-201-10aa |
| Genome Position | chr1:160537170-160537187,160570939-160570950[+] |
| Species | Human |
| Peptide Sequence | MVASAVARRS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.51 |
| Relative Molecular Mass | 1209.36 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000234425;AL138930.1 |
| Transcript ID/Name | ENST00000446952;AL138930.1-201 |
| Transcript Length | 635 |
| Coding Ability | 0.2898 |
| DNA Sequence Corresponding to Peptide | ATGGTGGCATCTGCAGTGGCCAGAAGGTCA |
m6A
|
Conservation
|
|
|