Basic information for AL139147.1-201-10aa
| Peptide Name | AL139147.1-201-10aa |
| Genome Position | chr1:66666920-66666949[-] |
| Species | Human |
| Peptide Sequence | MGENFCSLLI |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.11 |
| Relative Molecular Mass | 1288.48 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000248458;AL139147.1 |
| Transcript ID/Name | ENST00000502413;AL139147.1-201 |
| Transcript Length | 1156 |
| Coding Ability | 0.4343 |
| DNA Sequence Corresponding to Peptide | ATGGGAGAAAATTTTTGTAGTCTACTCATC |
|
Conservation
|
|
|