Basic information for AL139243.1-201-10aa
| Peptide Name | AL139243.1-201-10aa |
| Genome Position | chr10:98453773-98453802[+] |
| Species | Human |
| Peptide Sequence | MTLTNIVNDI |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.7 |
| Relative Molecular Mass | 1295.53 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000287261;AL139243.1 |
| Transcript ID/Name | ENST00000660697;AL139243.1-201 |
| Transcript Length | 1058 |
| Coding Ability | 0.3204 |
| DNA Sequence Corresponding to Peptide | ATGACTTTAACTAATATAGTCAATGACATC |
|
Conservation
|
|
|