Basic information for AL158064.1-206-10aa-3
| Peptide Name | AL158064.1-206-10aa-3 |
| Genome Position | chr13:80063518-80063547[-] |
| Species | Human |
| Peptide Sequence | MFSIILKQLD |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.96 |
| Relative Molecular Mass | 1369.61 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000284196;AL158064.1 |
| Transcript ID/Name | ENST00000640346;AL158064.1-206 |
| Transcript Length | 4082 |
| Coding Ability | 0.3697 |
| DNA Sequence Corresponding to Peptide | ATGTTCTCCATCATCCTGAAGCAGCTGGAT |
|
Conservation
|
|
|